Analogy/Homology Post

HOMOLOGS

1. Two different species I found that possess the homologus trait are the frog and the lizard. A frog is a tailless amphibian with a squat body, and the lizard is a reptile with a long body and tail. According to the website dictionary.com in the article entitled Homology in the Animal Kingdom, last accessed on February 2015, it states, "Though they clearly look different, they both share the same common ancestor and a common set of bones (the radius, ulna, humerus)".

b. The trait these two animals have in common are their forelimbs. The forelimbs of a frog and a lizard look very different because they have evolved differently to assist in the specific lifestyles of each animal. The forelimbs of a frog consist of a humerus, radioulna, carpals, metacarpals, and phalanges; where a lizards forelimbs consist of a humerus, ulna, radius, radiale, centrales, metacarpals and distalia. The frog uses its hind forelimbs for swimming and leaping, and its smaller, upper limbs for steering when it is swimming and for absorption of shock when landing after a jump. The lizard uses its forelimbs for running, balancing, gripping and for holding on to things. The traits are different because it is necessary in order for the animal to survive in its environment. The frog is a water animal, where the lizard lives mainly on land.

c.The common ancestor they share is called Eusthenopteron, a now extinct Devonian lobe-finned fish that lived 385 million years ago. We know that Eusthenopteron possessed this trait because of fossils that have been found and studied, indicating that this animal also had a humerus, ulna, and radius.
(See photo above) Though Eusthenopteron was a fish, it sometimes came up on land to search for food when none was found on the ocean floor.

ANALOGS

1. Two species that I found to possess the analogous trait are the Platypus and Duck. Contrary to what some people may think, they are not, both birds. One is a bird, and the other is a mammal. Both however, do lay eggs.

b. As previously stated, they are both egg laying creatures that have webbed feet, and a soft, smooth rubbery snout. A platypus lays one to two eggs at a time and keeps them warm by holding them between her body and tail. The eggs hatch in about ten days. On the other hand, a duck can lay between 9 to 12 eggs at a time (depending on the type of duck), which it buries in a nest till they are ready to hatch about 28 days later. 

c. I do believe the common ancestor in both could have shared this trait because otherwise, I don't think a platypus would be able to lay eggs if it is a mammal, I don't see the point to it. Why not instead just give birth to its babies like other mammals? I think we know it is an analogous trait because its clear that they are not alike, aside from the snout they both possess and the fact that they both lay eggs, they look and are nothing alike. I think the platypus looks more like a mixture of a seal and a beaver.   

DNA STRAND POST

CTAGATGGTTCCCTTGCCTGCCGGTCGTTCGGACAATTCAGGAAAGTAGGTAC

Who Said It Best to Charles Darwin

Upon reading up on all five of the individuals who influenced Darwin in one way or another, I believe that the one who was most influential to him and his work was Alfred Russell Wallace. (It has also been said that Wallace was the one who originally came up with the theory of Natural Selection and Darwin took credit for the work). In the Encyclopedia Britannica's website article entitled "Alfred Russell Wallace: The Career of a Naturalist" last accessed on February 2015, it says that Wallace co-wrote an article with Darwin called "On the Tendency of Species to Form Varieties; and on the Perpetuation of Varieties and Species by Natural Selection", which was both of their theories combined into one. Wallace believed that species arise by outliving the parent species in the struggle to survive. In the same article, it states: "Every species has come into existence coincident both in space and time with a pre-existing closely allied species.... New species arise by the progression and continued divergence of varieties that outlive the parent species in the struggle for existence". In other words, what this means is that although species evolve and change with time as was Darwin's argument in his theory, only the strongest evolve and survive, but still have a bit of the genes/organisms of the original species. Wallace believed that animals and the animal population would increase or change based on the environment that they were in. They needed to grow or mutate in order to adapt to their changing environment, but would not do so if the environment was the same; it was not necessary. As we can clearly see, Wallaces' work was very influential to Darwin, being as how we see the similarities in Darwin's work. In Darwin's theory, we can see Wallaces' beliefs at play, Darwin believed in Common Descent, which was that "organisms are descended from one another, or several common ancestors and have diversified from this original stock", a point that Wallace talks about in his works and believed in. I think that Darwin could have developed his theory of Natural Selection without Wallace's influence, being as how they both agreed with one another on certain things, but I think that Darwin needed confirmation, per say, about what he believed and he found that in Wallace, maybe not entirely, as we can now see that Darwin tweaked bits of Wallace's work that he did not agree with. Upon publication, the book "The Origin of Species" was met with mixed reviews. The church of England was against it, while liberal Anglicans were all for it.

I accessed my information from the website: http://www.britannica.com/EBchecked/topic/634738/Alfred-Russel-Wallace/93553/The-career-of-a-naturalist

Stranded On A Deserted Island- Blog 1.

If I were stranded on a deserted island, the two things I would bring would be a pot and a lighter. I chose these two things for the following reasons. I would bring a pot so that I could catch water in it and boil it for drinking (being as how they say the body can survive longer without food, but not water). I would bring a lighter for the obvious reason, which is to make fire to cook and to keep warm and safe at night. I would also use the lighter to start a fire to try and catch someone's attention and in turn be rescued off the island. :) I would have said I would bring my two daughter's with me, but as much as I adore them, I wouldn't want them to suffer. God knows how long we'd be there. Besides, given that the lighter helps me get rescued, I'd be back with them in no time! :P